Online Inquiry
BCL2 cDNA ORF Clone, Human, N-His tag
SPD-01535
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Bcl-2 |
| Gene Abbr. | BCL2 |
| Gene ID | 596 |
| Full Name | BCL2 apoptosis regulator |
| Alias | Bcl-2, PPP1R50 |
| Introduction | Bcl-2 exerts a survival function in response to a wide range of apoptotic stimuli through inhibition of mitochondrial cytochrome c release. It has been implicated in modulating mitochondrial calcium homeostasis and proton flux. Several phosphorylation sites have been identified within Bcl-2 including Thr56, Ser70, Thr74, and Ser87. It has been suggested that these phosphorylation sites may be targets of the ASK1/MKK7/JNK1 pathway and that phosphorylation of Bcl-2 may be a marker for mitotic events. Mutation of Bcl-2 at Thr56 or Ser87 inhibits its anti-apoptotic activity during glucocorticoid-induced apoptosis of T lymphocytes. Interleukin-3 and JNK-induced Bcl-2 phosphorylation at Ser70 may be required for its enhanced anti-apoptotic functions. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha with N terminal His tag. |
| NCBI Ref Seq | NM_000633.2 |
| RefSeq ORF Size | 720 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 0.77kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.