Online Inquiry
BCHE Knockout Cell Line
SPL-00624
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp insertion |
| Target Information | |
|---|---|
| Target Name | BCHE |
| Gene Abbr. | BCHE |
| Gene ID | 590 |
| Full Name | butyrylcholinesterase |
| Alias | BCHED, CHE1, CHE2, E1 |
| Species | Human |
| Genomic Locus | chr3:165830819 |
| Transcript | NM_000055 |
| WT Expression Level | 0.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp insertion in a coding exon of BCHE. |
| Description | 5bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTGAATCGAAGTCTACCAAG |
| PCR Primer |
Forward: AGGTGCTGGAATCCATACATTTAGA Reverse: TGCTTATTGGGAAGTCACATACTGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.