Bcap31 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Bcap31 cDNA ORF Clone, Mouse, untagged

Bcap31 cDNA ORF Clone, Mouse, untagged

SPD-01497

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse B cell receptor associated protein 31.
Target Information
Species Mouse
Target Name BCAP31
Gene Abbr. Bcap31
Gene ID 27061
Full Name B cell receptor associated protein 31
Alias BAP, Bap31
Product Details
Description Full length Clone DNA of Mouse B cell receptor associated protein 31.
NCBI Ref Seq NM_012060.4
RefSeq ORF Size 738 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.