BCAP29 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BCAP29 cDNA ORF Clone, Human, untagged

BCAP29 cDNA ORF Clone, Human, untagged

SPD-01457

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human B-cell receptor-associated protein 29.
Target Information
Species Human
Target Name BCAP29
Gene Abbr. BCAP29
Gene ID 55973
Full Name B cell receptor associated protein 29
Alias BAP29
Product Details
Description Full length Clone DNA of Human B-cell receptor-associated protein 29.
NCBI Ref Seq BC008478
RefSeq ORF Size 726 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.