Online Inquiry
BAZ1B Knockout Cell Line
SPL-00617
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | BAZ1B |
| Gene Abbr. | BAZ1B |
| Gene ID | 9031 |
| Full Name | bromodomain adjacent to zinc finger domain 1B |
| Alias | WBSCR10, WBSCR9, WSTF |
| Species | Human |
| Genomic Locus | chr7:73510813 |
| Transcript | NM_032408 |
| WT Expression Level | 66.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of BAZ1B. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGGTACAGTGAGCGCATT |
| PCR Primer |
Forward: TGTGCCCCATAAACTTAAATACACA Reverse: CAGTCTTAGTCATCTTGCTTTGGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.