Online Inquiry
BAZ1A Knockout Cell Line
SPL-00616
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | BAZ1A |
| Gene Abbr. | BAZ1A |
| Gene ID | 11177 |
| Full Name | bromodomain adjacent to zinc finger domain 1A |
| Alias | ACF1, WALp1, WCRF180, hACF1 |
| Species | Human |
| Genomic Locus | chr14:34874532 |
| Transcript | NM_013448 |
| WT Expression Level | 83.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of BAZ1A. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAACTTCCTCGTCGGGCCGC |
| PCR Primer |
Forward: TCACTTTCAAGTCGCCCCG Reverse: GCTTTCCTTTCCCTCCAATTTTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.