Bax cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Bax cDNA ORF Clone, Mouse, untagged

Bax cDNA ORF Clone, Mouse, untagged

SPD-01437

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse BCL2-associated X protein.
Target Information
Species Mouse
Target Name BAX
Gene Abbr. Bax
Gene ID 12028
Full Name BCL2-associated X protein
Introduction Bax is a key component for cellular induced apoptosis through mitochondrial stress. Upon apoptotic stimulation, Bax forms oligomers and translocates from the cytosol to the mitochondrial membrane. Through interactions with pore proteins on the mitochondrial membrane, Bax increases the membrane's permeability, which leads to the release of cytochrome c from mitochondria, activation of caspase-9 and initiation of the caspase activation pathway for apoptosis.
Product Details
Description Full length Clone DNA of Mouse BCL2-associated X protein.
NCBI Ref Seq NM_007527.3
RefSeq ORF Size 579 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.58kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.