Online Inquiry
BAX cDNA ORF Clone, Human, untagged
SPD-01447
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BCL2-associated X protein. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | BAX |
| Gene Abbr. | BAX |
| Gene ID | 581 |
| Full Name | BCL2 associated X, apoptosis regulator |
| Alias | BCL2L4 |
| Introduction | Bax is a key component for cellular induced apoptosis through mitochondrial stress. Upon apoptotic stimulation, Bax forms oligomers and translocates from the cytosol to the mitochondrial membrane. Through interactions with pore proteins on the mitochondrial membrane, Bax increases the membrane's permeability, which leads to the release of cytochrome c from mitochondria, activation of caspase-9 and initiation of the caspase activation pathway for apoptosis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BCL2-associated X protein. |
| NCBI Ref Seq | NM_138761.3 |
| RefSeq ORF Size | 579 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 0.58kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.