Online Inquiry
Bak1 cDNA ORF Clone, Mouse, C-HA tag
SPD-01420
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse BCL2-antagonist/killer 1 with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Bak |
Gene Abbr. | Bak1 |
Gene ID | 12018 |
Full Name | BCL2-antagonist/killer 1 |
Alias | Ba, Bak, N-B, N-BAK1, N-Bak |
Introduction | Bak is a proapoptotic member of the Bcl-2 family. This protein is located on the outer membrane of mitochondria and is an essential component for transduction of apoptotic signals through the mitochondrial pathway. Upon apoptotic stimulation, an upstream stimulator like truncated BID (tBID) induces conformational changes in Bak to form oligomer channels in the mitochondrial membrane for cytochrome c release. The release of cytochrome c to the cytosol activates the caspase-9 pathway and eventually leads to cell death. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse BCL2-antagonist/killer 1 with C terminal HA tag. |
NCBI Ref Seq | NM_007523.2 |
RefSeq ORF Size | 630 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.