Bak1 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Bak1 cDNA ORF Clone, Mouse, C-FLAG tag

Bak1 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-01417

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse BCL2-antagonist/killer 1 with C terminal Flag tag.
Target Information
Species Mouse
Target Name Bak
Gene Abbr. Bak1
Gene ID 12018
Full Name BCL2-antagonist/killer 1
Alias Ba, Bak, N-B, N-BAK1, N-Bak
Introduction Bak is a proapoptotic member of the Bcl-2 family. This protein is located on the outer membrane of mitochondria and is an essential component for transduction of apoptotic signals through the mitochondrial pathway. Upon apoptotic stimulation, an upstream stimulator like truncated BID (tBID) induces conformational changes in Bak to form oligomer channels in the mitochondrial membrane for cytochrome c release. The release of cytochrome c to the cytosol activates the caspase-9 pathway and eventually leads to cell death.
Product Details
Description Full length Clone DNA of Mouse BCL2-antagonist/killer 1 with C terminal Flag tag.
NCBI Ref Seq NM_007523.2
RefSeq ORF Size 669 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.67kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.