Online Inquiry
BAK1 cDNA ORF Clone, Human, untagged
SPD-01436
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BCL2-antagonist/killer 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Bak |
| Gene Abbr. | BAK1 |
| Gene ID | 578 |
| Full Name | BCL2 antagonist/killer 1 |
| Alias | BAK, BAK-LIKE, BCL2L7, CDN1 |
| Introduction | Bak is a proapoptotic member of the Bcl-2 family. This protein is located on the outer membrane of mitochondria and is an essential component for transduction of apoptotic signals through the mitochondrial pathway. Upon apoptotic stimulation, an upstream stimulator like truncated BID (tBID) induces conformational changes in Bak to form oligomer channels in the mitochondrial membrane for cytochrome c release. The release of cytochrome c to the cytosol activates the caspase-9 pathway and eventually leads to cell death. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BCL2-antagonist/killer 1. |
| NCBI Ref Seq | NM_001188.3 |
| RefSeq ORF Size | 636 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 0.64kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.