BAD cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

BAD cDNA ORF Clone, Human, C-Myc tag

BAD cDNA ORF Clone, Human, C-Myc tag

SPD-01378

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BCL2-antagonist of cell death (BAD), transcript variant 1 with C terminal Myc tag.
Target Information
Species Human
Target Name BAD
Gene Abbr. BAD
Gene ID 572
Full Name BCL2 associated agonist of cell death
Alias BBC2, BCL2L8
Introduction Bad is a proapoptotic member of the Bcl-2 family that promotes cell death by displacing Bax from binding to Bcl-2 and Bcl-xL. Survival factors, such as IL-3, inhibit the apoptotic activity of Bad by activating intracellular signaling pathways that result in the phosphorylation of Bad at Ser112 and Ser136. Phosphorylation at these sites promotes binding of Bad to 14-3-3 proteins to prevent an association between Bad with Bcl-2 and Bcl-xL. Akt phosphorylates Bad at Ser136 to promote cell survival. Bad is phosphorylated at Ser112 both in vivo and in vitro by p90RSK and mitochondria-anchored PKA. Phosphorylation at Ser155 in the BH3 domain by PKA plays a critical role in blocking the dimerization of Bad and Bcl-xL.
Product Details
Description Full length Clone DNA of Human BCL2-antagonist of cell death (BAD), transcript variant 1 with C terminal Myc tag.
NCBI Ref Seq NM_004322.2
RefSeq ORF Size 507 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.