Online Inquiry
B4GALNT3 Knockout Cell Line
SPL-00606
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | B4GALNT3 |
| Gene Abbr. | B4GALNT3 |
| Gene ID | 283358 |
| Full Name | beta-1,4-N-acetyl-galactosaminyltransferase 3 |
| Species | Human |
| Genomic Locus | chr12:536223 |
| Transcript | NM_173593 |
| WT Expression Level | 8.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of B4GALNT3. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCACCCCTTGGTCAATGTCG |
| PCR Primer |
Forward: AAATTCAGAAAAGTGAAGGAACCCG Reverse: GTACGGTAGAAGGTCCCTAGTAGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.