B3GNT4 Knockout Cell Line - CD BioSciences

service-banner

B3GNT4 Knockout Cell Line

B3GNT4 Knockout Cell Line

SPL-00594

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name B3GNT4
Gene Abbr. B3GNT4
Gene ID 79369
Full Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Alias B3GN-T4, beta3Gn-T4
Species Human
Genomic Locus chr12:122206412
Transcript NM_030765
WT Expression Level 1.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of B3GNT4.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence CGTGGGGTCTCCTGCGGGCT
PCR Primer Forward: TGAGAATAAAAAGTCCAGAGGCCAG
Reverse: CAGCAAGATAGAGAAATTTCGGCAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.