AXIN1 Knockout Cell Line - CD BioSciences

service-banner

AXIN1 Knockout Cell Line

AXIN1 Knockout Cell Line

SPL-00582

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name Axin1
Gene Abbr. AXIN1
Gene ID 8312
Full Name axin 1
Alias AXIN, PPP1R49
Species Human
Genomic Locus chr16:346162
Transcript NM_181050
WT Expression Level 32.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of AXIN1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TTCGCTGTACCGTCTACTGG
PCR Primer Forward: AAGAACAGAACCAAAATTCAACCCC
Reverse: ATGAAGATGAGGAATGGAAGTGTGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.