Online Inquiry
AXIN1 Knockout Cell Line
SPL-00582
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | Axin1 |
Gene Abbr. | AXIN1 |
Gene ID | 8312 |
Full Name | axin 1 |
Alias | AXIN, PPP1R49 |
Species | Human |
Genomic Locus | chr16:346162 |
Transcript | NM_181050 |
WT Expression Level | 32.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of AXIN1. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTCGCTGTACCGTCTACTGG |
PCR Primer |
Forward: AAGAACAGAACCAAAATTCAACCCC Reverse: ATGAAGATGAGGAATGGAAGTGTGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.