Online Inquiry
ATP6V0A2 Knockout Cell Line
SPL-00569
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
5bp deletion |
Target Information | |
---|---|
Target Name | ATP6V0A2 |
Gene Abbr. | ATP6V0A2 |
Gene ID | 23545 |
Full Name | ATPase H+ transporting V0 subunit a2 |
Alias | A2, ARCL, ARCL2A, ATP6A2, ATP6N1D |
Species | Human |
Genomic Locus | chr12:123718631 |
Transcript | NM_012463 |
WT Expression Level | 13.12 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a subunit of the vacuolar ATPase (v-ATPase), an heteromultimeric enzyme that is present in intracellular vesicles and in the plasma membrane of specialized cells, and which is essential for the acidification of diverse cellular components. V-ATPase is comprised of a membrane peripheral V(1) domain for ATP hydrolysis, and an integral membrane V(0) domain for proton translocation. The subunit encoded by this gene is a component of the V(0) domain. Mutations in this gene are a cause of both cutis laxa type II and wrinkly skin syndrome. [provided by RefSeq, Jul 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ATP6V0A2. |
Description | 5bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTTGGAAAGAACTTACGTTC |
PCR Primer |
Forward: GGTAACAGTTGACAAATTGCTCTCA Reverse: TTTTAAACCGAACAAGGTTTGCCTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.