Online Inquiry
ATP5ME Knockout Cell Line
SPL-00564
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
5bp deletion |
Target Information | |
---|---|
Target Name | ATP5ME |
Gene Abbr. | ATP5ME |
Gene ID | 521 |
Full Name | ATP synthase membrane subunit e |
Alias | ATP5I, ATP5K |
Species | Human |
Genomic Locus | chr4:673312 |
Transcript | NM_007100 |
WT Expression Level | 583.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the e subunit of the Fo complex. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ATP5I. |
Description | 5bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GAAACGGATTGCCAGAGAAT |
PCR Primer |
Forward: TCCCCATTTTTAAACAATCCGCATC Reverse: TCAGTTCCTTTTGTACAGCATTTCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.