ATP5ME Knockout Cell Line - CD BioSciences

service-banner

ATP5ME Knockout Cell Line

ATP5ME Knockout Cell Line

SPL-00563

Size Price
1 Unit Online Inquiry
Description
203bp insertion
Target Information
Target Name ATP5ME
Gene Abbr. ATP5ME
Gene ID 521
Full Name ATP synthase membrane subunit e
Alias ATP5I, ATP5K
Species Human
Genomic Locus chr4:674219
Transcript NM_007100
WT Expression Level 583.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the e subunit of the Fo complex. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 203bp insertion in a coding exon of ATP5I.
Description 203bp insertion
Parental Cell Line C631
Guide RNA Sequence AGCGGAGAGACCTGCACCGG
PCR Primer Forward: CCAGAGCTGGAGTTCTCCAAATAG
Reverse: CAGTCACCCTTCGGTCGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.