Online Inquiry
ATG7 Knockout Cell Line
SPL-00547
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
7bp deletion |
Target Information | |
---|---|
Target Name | Atg7 |
Gene Abbr. | ATG7 |
Gene ID | 10533 |
Full Name | autophagy related 7 |
Alias | APG7-LIKE, APG7L, GSA7 |
Species | Human |
Genomic Locus | chr3:11298790 |
Transcript | NM_006395 |
WT Expression Level | 16.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ATG7. |
Description | 7bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGAAGAAGCTGAACGAGTAT |
PCR Primer |
Forward: GAACTGGGATCAAAAAGTCAGGAAG Reverse: CACCAGGTTTTGCATGGATATGTTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.