Online Inquiry
ATG7 cDNA ORF Clone, Human, untagged
SPD-01341
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human autophagy related 7. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Atg7 |
| Gene Abbr. | ATG7 |
| Gene ID | 10533 |
| Full Name | autophagy related 7 |
| Alias | APG7-LIKE, APG7L, GSA7 |
| Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but has also been associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related (Atg) genes. Formation of the autophagosome involves a ubiquitin-like conjugation system in which Atg12 is covalently bound to Atg5 and targeted to autophagosome vesicles. This conjugation reaction is mediated by the ubiquitin E1-like enzyme Atg7 and the E2-like enzyme Atg10. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human autophagy related 7. |
| NCBI Ref Seq | NM_006395.2 |
| RefSeq ORF Size | 2112 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.11kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.