Atg5 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Atg5 cDNA ORF Clone, Mouse, C-His tag

Atg5 cDNA ORF Clone, Mouse, C-His tag

SPD-01313

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse autophagy related 5 with C terminal His tag.
Target Information
Species Mouse
Target Name Atg5
Gene Abbr. Atg5
Gene ID 11793
Full Name autophagy related 5
Alias 2010107M05Rik, 3110067M24Rik, AW319544, Ap, Apg5l
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but has also been associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related (Atg) genes. Formation of the autophagosome involves a ubiquitin-like conjugation system in which Atg12 is covalently bound to Atg5 and targeted to autophagosome vesicles. This conjugation reaction is mediated by the ubiquitin E1-like enzyme Atg7 and the E2-like enzyme Atg10.
Product Details
Description Full length Clone DNA of Mouse autophagy related 5 with C terminal His tag.
NCBI Ref Seq NM_053069.5
RefSeq ORF Size 873 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.87kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.