ATG4D cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ATG4D cDNA ORF Clone, Human, untagged

ATG4D cDNA ORF Clone, Human, untagged

SPD-01311

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 4D, cysteine peptidase.
Target Information
Species Human
Target Name Atg4D
Gene Abbr. ATG4D
Gene ID 84971
Full Name autophagy related 4D cysteine peptidase
Alias APG4-D, APG4D, AUTL4
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Control of autophagy was largely discovered in yeast and involves proteins encoded by a set of autophagy-related genes (Atg). Formation of autophagic vesicles requires a pair of essential ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8-phosphatidylethanolamine (Atg8-PE), which are widely conserved in eukaryotes. Numerous mammalian counterparts to yeast Atg proteins have been described, including three Atg8 proteins (GATE-16, GABARAP, and LC3) and four Atg4 homologs (Atg4A/autophagin-2, Atg4B/autophagin-1, Atg4C/autophagin-3, and Atg4D/autophagin-4). The cysteine protease Atg4 is pivotal to autophagosome membrane generation and regulation. Atg4 primes the Atg8 homolog for lipidation by cleaving its carboxy terminus and exposing its glycine residue for E1-like enzyme Atg7. The Atg8 homolog is transferred to the E2-like enzyme Atg3 before forming the Atg8-PE conjugate. During later stages of autophagy, Atg4 can reverse this lipidation event by cleaving PE, thereby recycling the Atg8 homolog.Atg4C-deficient mice display a tissue-specific decrease in LC3 lipidation only when under stressful conditions such as prolonged starvation. Mutant mice also exhibit increased susceptibility to the development of chemical carcinogen induced fibrosarcomas suggesting that Atg4C may contribute to events associated with tumor progression.
Product Details
Description Full length Clone DNA of Human autophagy related 4D, cysteine peptidase.
NCBI Ref Seq BC068992
RefSeq ORF Size 1425 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.