Online Inquiry
ATG4C cDNA ORF Clone, Human, N-HA tag
SPD-01300
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human autophagy related 4C, cysteine peptidase with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Atg4C |
| Gene Abbr. | ATG4C |
| Gene ID | 84938 |
| Full Name | autophagy related 4C cysteine peptidase |
| Alias | APG4-C, APG4C, AUTL1, AUTL3 |
| Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Control of autophagy was largely discovered in yeast and involves proteins encoded by a set of autophagy-related genes (Atg). Formation of autophagic vesicles requires a pair of essential ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8-phosphatidylethanolamine (Atg8-PE), which are widely conserved in eukaryotes. Numerous mammalian counterparts to yeast Atg proteins have been described, including three Atg8 proteins (GATE-16, GABARAP, and LC3) and four Atg4 homologs (Atg4A/autophagin-2, Atg4B/autophagin-1, Atg4C/autophagin-3, and Atg4D/autophagin-4). The cysteine protease Atg4 is pivotal to autophagosome membrane generation and regulation. Atg4 primes the Atg8 homolog for lipidation by cleaving its carboxy terminus and exposing its glycine residue for E1-like enzyme Atg7. The Atg8 homolog is transferred to the E2-like enzyme Atg3 before forming the Atg8-PE conjugate. During later stages of autophagy, Atg4 can reverse this lipidation event by cleaving PE, thereby recycling the Atg8 homolog.Atg4C-deficient mice display a tissue-specific decrease in LC3 lipidation only when under stressful conditions such as prolonged starvation. Mutant mice also exhibit increased susceptibility to the development of chemical carcinogen induced fibrosarcomas suggesting that Atg4C may contribute to events associated with tumor progression. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human autophagy related 4C, cysteine peptidase with N terminal HA tag. |
| NCBI Ref Seq | BC033024 |
| RefSeq ORF Size | 1419 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | HindIII + NotI (6kb + 1.42kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.