ATG4B cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ATG4B cDNA ORF Clone, Human, N-FLAG tag

ATG4B cDNA ORF Clone, Human, N-FLAG tag

SPD-01287

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 4B, cysteine peptidase with N terminal Flag tag.
Target Information
Species Human
Target Name Atg4B
Gene Abbr. ATG4B
Gene ID 23192
Full Name autophagy related 4B cysteine peptidase
Alias APG4B, AUTL1
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Control of autophagy was largely discovered in yeast and involves proteins encoded by a set of autophagy-related genes (Atg). Formation of autophagic vesicles requires a pair of essential ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8-phosphatidylethanolamine (Atg8-PE), which are widely conserved in eukaryotes. Numerous mammalian counterparts to yeast Atg proteins have been described, including three Atg8 proteins (GATE-16, GABARAP, and LC3) and four Atg4 homologs (Atg4A/autophagin-2, Atg4B/autophagin-1, Atg4C/autophagin-3, and Atg4D/autophagin-4). The cysteine protease Atg4 is pivotal to autophagosome membrane generation and regulation. Atg4 primes the Atg8 homolog for lipidation by cleaving its carboxy terminus and exposing its glycine residue for E1-like enzyme Atg7. The Atg8 homolog is transferred to the E2-like enzyme Atg3 before forming the Atg8-PE conjugate. During later stages of autophagy, Atg4 can reverse this lipidation event by cleaving PE, thereby recycling the Atg8 homolog.While Atg4B displays a broad specificity for Atg8 homologues, it preferentially cleaves LC3. Mutation in the corresponding Atg4B gene can be associated with strong inhibition of autophagosome formation. An excess of inactive Atg4B blocks lipidation of Atg8 homologues and inhibits autophagy. This makes Atg4B a potential tool for characterization of the isolation membrane and other autophagy studies.
Product Details
Description Full length Clone DNA of Human autophagy related 4B, cysteine peptidase with N terminal Flag tag.
NCBI Ref Seq NM_013325.4
RefSeq ORF Size 1182 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.