Online Inquiry
Atg3 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-01230
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse autophagy related 3 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Atg3 |
Gene Abbr. | Atg3 |
Gene ID | 67841 |
Full Name | autophagy related 3 |
Alias | 2610016C12Rik, AP, APG3, Apg3l, Atg3l |
Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related genes (Atg). Formation of the autophagic vesicles involves two ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8-phosphatidylethanolamine (Atg8-PE), which are essential for autophagy and widely conserved in eukaryotes. There are at least three Atg8 homologs in mammalian cells, GATE-16, GABARAP, and LC3, that are conjugated by lipids. Lipid conjugation of Atg8 and its mammalian homologs requires Atg3 (Apg3p/Aut1p in yeast), an ubiquitously expressed E2-like enzyme. Following C-terminal cleavage by the cysteine protease Atg4, the exposed glycine residue of Atg8 binds to the E1-like enzyme Atg7, is transferred to Atg3, and then conjugated to phophatidylethanolamine. Atg3-deficient mice die within 1 day after birth and are completely defective for the conjugation of Atg8 homlogs and autophagome formation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse autophagy related 3 with C terminal Flag tag. |
NCBI Ref Seq | NM_026402.3 |
RefSeq ORF Size | 945 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.