ATG3 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

ATG3 cDNA ORF Clone, Human, N-Myc tag

ATG3 cDNA ORF Clone, Human, N-Myc tag

SPD-01248

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 3 with N terminal Myc tag.
Target Information
Species Human
Target Name Atg3
Gene Abbr. ATG3
Gene ID 64422
Full Name autophagy related 3
Alias APG3, APG3-LIKE, APG3L, PC3-96
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related genes (Atg). Formation of the autophagic vesicles involves two ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8-phosphatidylethanolamine (Atg8-PE), which are essential for autophagy and widely conserved in eukaryotes. There are at least three Atg8 homologs in mammalian cells, GATE-16, GABARAP, and LC3, that are conjugated by lipids. Lipid conjugation of Atg8 and its mammalian homologs requires Atg3 (Apg3p/Aut1p in yeast), an ubiquitously expressed E2-like enzyme. Following C-terminal cleavage by the cysteine protease Atg4, the exposed glycine residue of Atg8 binds to the E1-like enzyme Atg7, is transferred to Atg3, and then conjugated to phophatidylethanolamine. Atg3-deficient mice die within 1 day after birth and are completely defective for the conjugation of Atg8 homlogs and autophagome formation.
Product Details
Description Full length Clone DNA of Human autophagy related 3 with N terminal Myc tag.
NCBI Ref Seq BC024221
RefSeq ORF Size 990 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.99kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.