ATG16L1 Knockout Cell Line - CD BioSciences

service-banner

ATG16L1 Knockout Cell Line

ATG16L1 Knockout Cell Line

SPL-00541

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name Atg16L1
Gene Abbr. ATG16L1
Gene ID 55054
Full Name autophagy related 16 like 1
Alias APG16L, ATG16A, ATG16L, IBD10, WDR30
Species Human
Genomic Locus chr2:233264940
Transcript NM_017974
WT Expression Level 16.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ATG16L1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence AAAGCTTAGTGCGCAGGTCT
PCR Primer Forward: GGATTATCCTGTAAACCATGGGGAT
Reverse: CACCTGGAGTCTTTTTCATTCTCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.