Online Inquiry
ATG16L1 Knockout Cell Line
SPL-00541
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | Atg16L1 |
| Gene Abbr. | ATG16L1 |
| Gene ID | 55054 |
| Full Name | autophagy related 16 like 1 |
| Alias | APG16L, ATG16A, ATG16L, IBD10, WDR30 |
| Species | Human |
| Genomic Locus | chr2:233264940 |
| Transcript | NM_017974 |
| WT Expression Level | 16.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ATG16L1. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGCTTAGTGCGCAGGTCT |
| PCR Primer |
Forward: GGATTATCCTGTAAACCATGGGGAT Reverse: CACCTGGAGTCTTTTTCATTCTCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.