ATG16L1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

ATG16L1 cDNA ORF Clone, Human, C-FLAG tag

ATG16L1 cDNA ORF Clone, Human, C-FLAG tag

SPD-01220

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 16-like 1 (S. cerevisiae) with C terminal Flag tag.
Target Information
Species Human
Target Name Atg16L1
Gene Abbr. ATG16L1
Gene ID 55054
Full Name autophagy related 16 like 1
Alias APG16L, ATG16A, ATG16L, IBD10, WDR30
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Control of autophagy was largely discovered in yeast and involves proteins encoded by a set of autophagy-related genes (Atg). Formation of autophagic vesicles requires a pair of essential ubiquitin-like conjugation systems, Atg12-Atg5 and Atg8 (LC3)-phosphatidylethanolamine (LC3-PE), which are widely conserved in eukaryotes.Mammalian Atg16L1, containing an amino-terminal coiled coil domain and carboxyl-terminal WD-repeats, has multiple isoforms produced by alternative splicing. Atg16L1 provides a functional link between the two crucial ubiquitin-like conjugation systems of autophagy. Atg16L1 binds Atg5 of the Atg12-Atg5 conjugate forming an 800 kDa multimeric complex. The Atg12-Atg-5-Atg16L1 complex localizes to pre-autophagosomal membranes where it determines the site of LC3 lipidation and catalyzes the reaction required for the formation of mature autophagosomes. Genome-wide association scanning revealed variations in the Atg16L1 gene associated with Crohn's disease. Mice lacking the coiled coil domain of Atg16L1 have impaired autophagosome formation and elevated inflammatory cytokines, consistent with its role in inflammatory disease pathogenesis. Hypomorphic Atg16L1 mice also show defects in autophagy and abnormalities in intestinal Paneth cell function similar to that found in Crohn's disease.
Product Details
Description Full length Clone DNA of Human autophagy related 16-like 1 (S. cerevisiae) with C terminal Flag tag.
NCBI Ref Seq NM_017974.3
RefSeq ORF Size 1806 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI (two restriction sites) + XbaI (6kb + 0.94kb + 0.88kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.