Online Inquiry
ATG14 cDNA ORF Clone, Human, N-His tag
SPD-01216
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human autophagy related 14 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Atg14 |
Gene Abbr. | ATG14 |
Gene ID | 22863 |
Full Name | autophagy related 14 |
Alias | ATG14L, BARKOR, KIAA0831 |
Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but is also associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and is directed by a number of autophagy-related (Atg) genes. These proteins are involved in the formation of autophagosomes, which are cytoplasmic vacuoles that are delivered to lysosomes for degradation. The class III type phosphoinositide 3-kinase (PI3K) Vps34 regulates vacuolar trafficking and autophagy. Multiple proteins associate with Vps34, including p105/Vps15, Beclin-1, UVRAG, Atg14, and Rubicon. Atg14 and Rubicon were identified based on their ability to bind to Beclin-1 and participate in unique complexes with opposing functions. Rubicon, which localizes to the endosome and lysosome, inhibits Vps34 lipid kinase activity; knockdown of Rubicon enhances autophagy and endocytic trafficking. In contrast, Atg14 localizes to autophagosomes, isolation membranes, and ER and can enhance Vps34 activity. Knockdown of Atg14 inhibits starvation-induced autophagy. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human autophagy related 14 with N terminal His tag. |
NCBI Ref Seq | BC109090 |
RefSeq ORF Size | 1479 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.