ATG14 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ATG14 cDNA ORF Clone, Human, N-FLAG tag

ATG14 cDNA ORF Clone, Human, N-FLAG tag

SPD-01215

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 14 with N terminal Flag tag.
Target Information
Species Human
Target Name Atg14
Gene Abbr. ATG14
Gene ID 22863
Full Name autophagy related 14
Alias ATG14L, BARKOR, KIAA0831
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but is also associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and is directed by a number of autophagy-related (Atg) genes. These proteins are involved in the formation of autophagosomes, which are cytoplasmic vacuoles that are delivered to lysosomes for degradation. The class III type phosphoinositide 3-kinase (PI3K) Vps34 regulates vacuolar trafficking and autophagy. Multiple proteins associate with Vps34, including p105/Vps15, Beclin-1, UVRAG, Atg14, and Rubicon. Atg14 and Rubicon were identified based on their ability to bind to Beclin-1 and participate in unique complexes with opposing functions. Rubicon, which localizes to the endosome and lysosome, inhibits Vps34 lipid kinase activity; knockdown of Rubicon enhances autophagy and endocytic trafficking. In contrast, Atg14 localizes to autophagosomes, isolation membranes, and ER and can enhance Vps34 activity. Knockdown of Atg14 inhibits starvation-induced autophagy.
Product Details
Description Full length Clone DNA of Human autophagy related 14 with N terminal Flag tag.
NCBI Ref Seq BC109090
RefSeq ORF Size 1518 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.