ATG13 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

ATG13 cDNA ORF Clone, Human, N-Myc tag

ATG13 cDNA ORF Clone, Human, N-Myc tag

SPD-01207

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human autophagy related 13 with N terminal Myc tag.
Target Information
Species Human
Target Name Atg13
Gene Abbr. ATG13
Gene ID 9776
Full Name autophagy related 13
Alias KIAA0652, PARATARG8
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but has also been associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related (Atg) genes.Atg13/Apg13 was originally identified in yeast as a constitutively expressed protein that was genetically linked to Atg1/Apg1, a protein kinase required for autophagy. Overexpression of Atg1 suppresses the defects in autophagy observed in Atg13 mutants. Autophagy requires a direct association between Atg1 and Atg13, and is inhibited by TOR-dependent phosphorylation of Atg13 under high-nutrient conditions. Similarly, mammalian Atg13 forms a complex with the Atg1 homologues ULK1/2, along with FIP200, which localizes to autophagic isolation membranes and regulates autophagosome biogenesis. mTOR phosphorylates both Atg13 and ULK1, suppressing ULK1 kinase activity and autophagy. ULK1 can directly phosphorylate Atg13 at a yet unidentified site, presumably to promote autophagy. Additional studies suggest that Atg13 and FIP200 can function independently of ULK1 and ULK2 to induce autophagy through an unknown mechanism.
Product Details
Description Full length Clone DNA of Human autophagy related 13 with N terminal Myc tag.
NCBI Ref Seq BC001331
RefSeq ORF Size 1488 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites HindIII + XbaI (6kb + 1.49kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.