Online Inquiry
ATG13 cDNA ORF Clone, Human, C-Myc tag
SPD-01202
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human autophagy related 13 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Atg13 |
Gene Abbr. | ATG13 |
Gene ID | 9776 |
Full Name | autophagy related 13 |
Alias | KIAA0652, PARATARG8 |
Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation but has also been associated with a number of physiological processes including development, differentiation, neurodegeneration, infection, and cancer. The molecular machinery of autophagy was largely discovered in yeast and referred to as autophagy-related (Atg) genes.Atg13/Apg13 was originally identified in yeast as a constitutively expressed protein that was genetically linked to Atg1/Apg1, a protein kinase required for autophagy. Overexpression of Atg1 suppresses the defects in autophagy observed in Atg13 mutants. Autophagy requires a direct association between Atg1 and Atg13, and is inhibited by TOR-dependent phosphorylation of Atg13 under high-nutrient conditions. Similarly, mammalian Atg13 forms a complex with the Atg1 homologues ULK1/2, along with FIP200, which localizes to autophagic isolation membranes and regulates autophagosome biogenesis. mTOR phosphorylates both Atg13 and ULK1, suppressing ULK1 kinase activity and autophagy. ULK1 can directly phosphorylate Atg13 at a yet unidentified site, presumably to promote autophagy. Additional studies suggest that Atg13 and FIP200 can function independently of ULK1 and ULK2 to induce autophagy through an unknown mechanism. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human autophagy related 13 with C terminal Myc tag. |
NCBI Ref Seq | BC001331 |
RefSeq ORF Size | 1443 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.