Online Inquiry
ATG12 Knockout Cell Line
SPL-00535
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | Atg12 |
| Gene Abbr. | ATG12 |
| Gene ID | 9140 |
| Full Name | autophagy related 12 |
| Alias | APG12, APG12L, FBR93, HAPG12 |
| Species | Human |
| Genomic Locus | chr5:115837683 |
| Transcript | NM_004707 |
| WT Expression Level | 34.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Autophagy is a process of bulk protein degradation in which cytoplasmic components, including organelles, are enclosed in double-membrane structures called autophagosomes and delivered to lysosomes or vacuoles for degradation. ATG12 is the human homolog of a yeast protein involved in autophagy (Mizushima et al., 1998 [PubMed 9852036]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ATG12. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGCGAACACGAACCATCCA |
| PCR Primer |
Forward: TATGTGGCTCCATATGCATTTCTAT Reverse: TCCATTCTCTTTAGATGTTTCAGTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.