ATF6B cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ATF6B cDNA ORF Clone, Human, untagged

ATF6B cDNA ORF Clone, Human, untagged

SPD-01149

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human activating transcription factor 6 beta.
Target Information
Species Human
Target Name ATF-6
Gene Abbr. ATF6B
Gene ID 1388
Full Name activating transcription factor 6 beta
Alias CREB-RP, CREBL1, G13
Product Details
Description Full length Clone DNA of Human activating transcription factor 6 beta.
NCBI Ref Seq BC008394
RefSeq ORF Size 957 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.96kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.