Online Inquiry
Atf6 cDNA ORF Clone, Mouse, untagged
SPD-01138
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse activating transcription factor 6. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | ATF-6 |
| Gene Abbr. | Atf6 |
| Gene ID | 226641 |
| Full Name | activating transcription factor 6 |
| Alias | 9130025P16Rik, 9630036G24, AA789574, Atf6alpha, ESTM4 |
| Introduction | ATF6 is a constitutively expressed, endoplasmic reticulum (ER) membrane-anchored transcription factor. ATF6 is a key transcriptional activator of the unfolded protein response (UPR), which allows mammalian cells to maintain cellular homeostasis when they are subjected to environmental and physiological stresses that target the ER (reviewed in Shen, 2005 & Prywes, 2005). The C-terminus of ATF6 is located in the ER lumen and its N-terminal DNA binding domain faces the cytosol. AFT6 plays a key role in the ER stress response by transmitting the ER stress signal across the ER membrane into the nucleus. The induction of new gene expression by ATF6 is an important aspect of the ER stress response. In response to certain stress conditions, ATF6 translocates from the ER to the Golgi. The 90 kDa full-length ATF6 is processed within the Golgi to its active 50 kDa form through sequential cleavage by site-1 and site-2 proteases (S1P and S2P). Proteolytic activation of ATF6 in the ER stress response is a mechanism to regulate membrane-bound factors, and is referred to as regulated intramembrane proteolysis. The N-terminal active ATF6 translocates to the nucleus where it binds to ER stress-response elements in ER stress-response genes (ERSRGs). ATF6 is a potent transcriptional activator of ERSRGs. The fully glycosylated form of ATF6, a 670 amino acid protein, exhibits an electrophoretic mobility of ~90 kDa in denaturing SDS-gels, in part because of the glycosylated modifications. ATF6 has 3 consensus sites for N-linked glycosylation and exists constitutively as a glycosylated protein. Differentially glycosylated ATF6 forms may result from mutations or experimental treatment. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse activating transcription factor 6. |
| NCBI Ref Seq | XM_011238796.2 |
| RefSeq ORF Size | 1968 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + NotI (6kb + 1.97kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.