Atf6 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Atf6 cDNA ORF Clone, Mouse, untagged

Atf6 cDNA ORF Clone, Mouse, untagged

SPD-01137

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse activating transcription factor 6.
Target Information
Species Mouse
Target Name ATF-6
Gene Abbr. Atf6
Gene ID 226641
Full Name activating transcription factor 6
Alias 9130025P16Rik, 9630036G24, AA789574, Atf6alpha, ESTM4
Introduction ATF6 is a constitutively expressed, endoplasmic reticulum (ER) membrane-anchored transcription factor. ATF6 is a key transcriptional activator of the unfolded protein response (UPR), which allows mammalian cells to maintain cellular homeostasis when they are subjected to environmental and physiological stresses that target the ER (reviewed in Shen, 2005 & Prywes, 2005). The C-terminus of ATF6 is located in the ER lumen and its N-terminal DNA binding domain faces the cytosol. AFT6 plays a key role in the ER stress response by transmitting the ER stress signal across the ER membrane into the nucleus. The induction of new gene expression by ATF6 is an important aspect of the ER stress response. In response to certain stress conditions, ATF6 translocates from the ER to the Golgi. The 90 kDa full-length ATF6 is processed within the Golgi to its active 50 kDa form through sequential cleavage by site-1 and site-2 proteases (S1P and S2P). Proteolytic activation of ATF6 in the ER stress response is a mechanism to regulate membrane-bound factors, and is referred to as regulated intramembrane proteolysis. The N-terminal active ATF6 translocates to the nucleus where it binds to ER stress-response elements in ER stress-response genes (ERSRGs). ATF6 is a potent transcriptional activator of ERSRGs. The fully glycosylated form of ATF6, a 670 amino acid protein, exhibits an electrophoretic mobility of ~90 kDa in denaturing SDS-gels, in part because of the glycosylated modifications. ATF6 has 3 consensus sites for N-linked glycosylation and exists constitutively as a glycosylated protein. Differentially glycosylated ATF6 forms may result from mutations or experimental treatment.
Product Details
Description Full length Clone DNA of Mouse activating transcription factor 6.
NCBI Ref Seq NM_001081304.1
RefSeq ORF Size 1971 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6kb + 1.97kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.