ATF4 cDNA ORF Clone, Ferret, untagged - CD BioSciences

service-banner

ATF4 cDNA ORF Clone, Ferret, untagged

ATF4 cDNA ORF Clone, Ferret, untagged

SPD-01114

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Ferret activating transcription factor 4.
Target Information
Species Ferret
Target Name ATF-4
Gene Abbr. ATF4
Gene ID 101680524
Full Name activating transcription factor 4
Introduction ATF-4, an activating transcription factor/cAMP-response element-binding protein family member, functions in the PERK and eIF2α ER stress responsive pathway. ER stress represses the translation of the majority of mRNAs, but selectively stimulates the translation of certain mRNAs including that of ATF-4. Induced expression of ATF-4 increases the expression of genes critical for the recovery from ER stress.
Product Details
Description Full length Clone DNA of Ferret activating transcription factor 4.
NCBI Ref Seq XM_004743292.1
RefSeq ORF Size 1056 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.