Online Inquiry
ATF4 cDNA ORF Clone, Ferret, C-HA tag
SPD-01108
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Ferret activating transcription factor 4 with C terminal HA tag. |
Target Information | |
---|---|
Species | Ferret |
Target Name | ATF-4 |
Gene Abbr. | ATF4 |
Gene ID | 101680524 |
Full Name | activating transcription factor 4 |
Introduction | ATF-4, an activating transcription factor/cAMP-response element-binding protein family member, functions in the PERK and eIF2α ER stress responsive pathway. ER stress represses the translation of the majority of mRNAs, but selectively stimulates the translation of certain mRNAs including that of ATF-4. Induced expression of ATF-4 increases the expression of genes critical for the recovery from ER stress. |
Product Details | |
---|---|
Description | Full length Clone DNA of Ferret activating transcription factor 4 with C terminal HA tag. |
NCBI Ref Seq | XM_004743292.1 |
RefSeq ORF Size | 1056 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.