ATF3 Knockout Cell Line - CD BioSciences

service-banner

ATF3 Knockout Cell Line

ATF3 Knockout Cell Line

SPL-00531

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name ATF-3
Gene Abbr. ATF3
Gene ID 467
Full Name activating transcription factor 3
Species Human
Genomic Locus chr1:212615237
Transcript NM_001674
WT Expression Level 30.06 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of ATF3.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence CTTTTGTGATGGACACCCCG
PCR Primer Forward: TGTTTGAGGATTTTGCTAACCTGAC
Reverse: GTTATGTACTTCTGTCTCCTCCCAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.