ATF2 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

ATF2 cDNA ORF Clone, Human, N-Myc tag

ATF2 cDNA ORF Clone, Human, N-Myc tag

SPD-01070

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-myc myelocytomatosis viral oncogene homolog (avian) with N terminal Myc tag.
Target Information
Species Human
Target Name ATF-2
Gene Abbr. ATF2
Gene ID 1386
Full Name activating transcription factor 2
Alias CRE-BP1, CREB-2, CREB2, HB16, TREB7
Introduction The transcription factor ATF-2 (also called CRE-BP1) binds to both AP-1 and CRE DNA response elements and is a member of the ATF/CREB family of leucine zipper proteins. ATF-2 interacts with a variety of viral oncoproteins and cellular tumor suppressors and is a target of the SAPK/JNK and p38 MAP kinase signaling pathways. Various forms of cellular stress, including genotoxic agents, inflammatory cytokines, and UV irradiation, stimulate the transcriptional activity of ATF-2. Cellular stress activates ATF-2 by phosphorylation of Thr69 and Thr71. Both SAPK and p38 MAPK have been shown to phosphorylate ATF-2 at these sites in vitro and in cells transfected with ATF-2. Mutations of these sites result in the loss of stress-induced transcription by ATF-2. In addition, mutations at these sites reduce the ability of E1A and Rb to stimulate gene expression via ATF-2.ATF-7 is another member of the ATF/CREB family of leucine zipper proteins. Similarly, Thr51 and Thr53 (corresponding to Thr69 and Thr71 of ATF-2, respectively) can be phosphorylated under different conditions.
Product Details
Description Full length Clone DNA of Human v-myc myelocytomatosis viral oncogene homolog (avian) with N terminal Myc tag.
NCBI Ref Seq NM_002467.3
RefSeq ORF Size 1365 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.42kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.