Atf1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Atf1 cDNA ORF Clone, Mouse, untagged

Atf1 cDNA ORF Clone, Mouse, untagged

SPD-01052

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse activating transcription factor 1.
Target Information
Species Mouse
Target Name ATF-1
Gene Abbr. Atf1
Gene ID 11908
Full Name activating transcription factor 1
Product Details
Description Full length Clone DNA of Mouse activating transcription factor 1.
NCBI Ref Seq NM_007497.3
RefSeq ORF Size 810 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.