Online Inquiry
ATAD2B Knockout Cell Line
SPL-00526
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 104bp insertion |
| Target Information | |
|---|---|
| Target Name | ATAD2B |
| Gene Abbr. | ATAD2B |
| Gene ID | 54454 |
| Full Name | ATPase family AAA domain containing 2B |
| Species | Human |
| Genomic Locus | chr2:23926563 |
| Transcript | NM_017552 |
| WT Expression Level | 7.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 104bp insertion in a coding exon of ATAD2B. |
| Description | 104bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGCCGGCGTCACTCTGGATG |
| PCR Primer |
Forward: TTCTTCACACAAAAGAGCCGGG Reverse: TTCTCGGGTCCAAGTCTCCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.