ATAD2 Knockout Cell Line - CD BioSciences

service-banner

ATAD2 Knockout Cell Line

ATAD2 Knockout Cell Line

SPL-00525

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name ATAD2
Gene Abbr. ATAD2
Gene ID 29028
Full Name ATPase family AAA domain containing 2
Alias ANCCA, CT137, PRO2000
Species Human
Genomic Locus chr8:123380623
Transcript NM_014109
WT Expression Level 52.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ATAD2.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence ATCTTAAAGCACGTGTCCGG
PCR Primer Forward: TTATAGCCCTAGAACCTTGATGACC
Reverse: ACAAAATGATTCTGCACAAAAAGCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.