ASPH Knockout Cell Line - CD BioSciences

service-banner

ASPH Knockout Cell Line

ASPH Knockout Cell Line

SPL-00521

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name ASPH
Gene Abbr. ASPH
Gene ID 444
Full Name aspartate beta-hydroxylase
Alias AAH, BAH, CASQ2BP1, FDLAB, HAAH
Species Human
Genomic Locus chr8:61684143
Transcript NM_004318
WT Expression Level 111.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ASPH.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence GGGAGGAAAGGCGGACTCTC
PCR Primer Forward: ATTCAAGACTCCTAAGAGATGTCAC
Reverse: TGACGTGTTTTGAGAATTTAACTGGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.