Online Inquiry
ASIC1 Knockout Cell Line
SPL-00516
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | ASIC1 |
| Gene Abbr. | ASIC1 |
| Gene ID | 41 |
| Full Name | acid sensing ion channel subunit 1 |
| Alias | ACCN2, ASIC, BNaC2 |
| Species | Human |
| Genomic Locus | chr12:50077230 |
| Transcript | NM_001095 |
| WT Expression Level | 13.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ASIC1. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGTGCTACACGTTCAACT |
| PCR Primer |
Forward: CATTCCCAAAGGGTGTTGAGATTC Reverse: CAGTGATAGAGATGGTGAGATGCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.