Online Inquiry
ASH1L Knockout Cell Line
SPL-00515
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 53bp deletion |
| Target Information | |
|---|---|
| Target Name | ASH1L |
| Gene Abbr. | ASH1L |
| Gene ID | 55870 |
| Full Name | ASH1 like histone lysine methyltransferase |
| Alias | ASH1, ASH1L1, KMT2H, MRD52 |
| Species | Human |
| Genomic Locus | chr1:155521354 |
| Transcript | NM_018489 |
| WT Expression Level | 7.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 53bp deletion in a coding exon of ASH1L. |
| Description | 53bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTTCTCGATTCCGTTTGCGA |
| PCR Primer |
Forward: ACAGTGTTCATTCTTTTCATCCGTC Reverse: TGCTATGTTAGGATTGGGTTCTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.