ARRB2 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

ARRB2 cDNA ORF Clone, Human, N-Myc tag

ARRB2 cDNA ORF Clone, Human, N-Myc tag

SPD-15777

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human arrestin, beta 2 with N terminal Myc tag.
Target Information
Species Human
Target Name β-Arrestin 2
Gene Abbr. ARRB2
Gene ID 409
Full Name arrestin beta 2
Alias ARB2, ARR2, BARR2
Introduction Arrestin proteins function as negative regulators of G protein-coupled receptor (GPCR) signaling. Cognate ligand binding stimulates GPCR phosphorylation, which is followed by binding of arrestin to the phosphorylated GPCR and the eventual internalization of the receptor and desensitization of GPCR signaling. Four distinct mammalian arrestin proteins are known. Arrestin 1 (also known as S-arrestin) and arrestin 4 (X-arrestin) are localized to retinal rods and cones, respectively. Arrestin 2 (also known as β-arrestin 1) and arrestin 3 (β-arrestin 2) are ubiquitously expressed and bind to most GPCRs. β-arrestins function as adaptor and scaffold proteins and play important roles in other processes, such as recruiting c-Src family proteins to GPCRs in Erk activation pathways. β-arrestins are also involved in some receptor tyrosine kinase signaling pathways. Additional evidence suggests that β-arrestins translocate to the nucleus and help regulate transcription by binding transcriptional cofactors.
Product Details
Description Full length Clone DNA of Human arrestin, beta 2 with N terminal Myc tag.
NCBI Ref Seq BC007427
RefSeq ORF Size 1230 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.