Online Inquiry
ARRB1 Knockout Cell Line
SPL-00481
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
122bp deletion |
Target Information | |
---|---|
Target Name | β-Arrestin 1 |
Gene Abbr. | ARRB1 |
Gene ID | 408 |
Full Name | arrestin beta 1 |
Alias | ARB1, ARR1 |
Species | Human |
Genomic Locus | chr11:75283374 |
Transcript | NM_020251 |
WT Expression Level | 24.63 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 1 is a cytosolic protein and acts as a cofactor in the beta-adrenergic receptor kinase (BARK) mediated desensitization of beta-adrenergic receptors. Besides the central nervous system, it is expressed at high levels in peripheral blood leukocytes, and thus the BARK/beta-arrestin system is believed to play a major role in regulating receptor-mediated immune functions. Alternatively spliced transcripts encoding different isoforms of arrestin beta 1 have been described. [provided by RefSeq, Jan 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 122bp deletion in a coding exon of ARRB1. |
Description | 122bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGGTGGGAACGACTGTACGT |
PCR Primer |
Forward: GGCTGGAGAAGAGACACTTACC Reverse: TCGCTCCCCACAGTCTATGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.