Online Inquiry
ARRB1 cDNA ORF Clone, Human, N-HA tag
SPD-15767
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human arrestin, beta 1 with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | β-Arrestin 1 |
| Gene Abbr. | ARRB1 |
| Gene ID | 408 |
| Full Name | arrestin beta 2 |
| Alias | ARB1, ARR1 |
| Introduction | Arrestin proteins function as negative regulators of G protein-coupled receptor (GPCR) signaling. Cognate ligand binding stimulates GPCR phosphorylation, which is followed by binding of arrestin to the phosphorylated GPCR and the eventual internalization of the receptor and desensitization of GPCR signaling. Four distinct mammalian arrestin proteins are known. Arrestin 1 (also known as S-arrestin) and arrestin 4 (X-arrestin) are localized to retinal rods and cones, respectively. Arrestin 2 (also known as β-arrestin 1) and arrestin 3 (β-arrestin 2) are ubiquitously expressed and bind to most GPCRs. β-arrestins function as adaptor and scaffold proteins and play important roles in other processes, such as recruiting c-Src family proteins to GPCRs in Erk activation pathways. β-arrestins are also involved in some receptor tyrosine kinase signaling pathways. Additional evidence suggests that β-arrestins translocate to the nucleus and help regulate transcription by binding transcriptional cofactors.Erk1/2 constitutively phosphorylates β-arrestin 1 at carboxy-terminal Ser412, which promotes cytosolic localization of the scaffold protein. Agonist stimulation of β2-adrenergic receptors results in recruitment of β-arrestin 1 to the plasma membrane and rapid dephosphorylation of arrestin. Dephosphorylation is an essential step of β-arrestin 1-mediated receptor endocytosis, but it is not required for receptor desensitization. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human arrestin, beta 1 with N terminal HA tag. |
| NCBI Ref Seq | BC003636 |
| RefSeq ORF Size | 1257 bp |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.