ARRB1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ARRB1 cDNA ORF Clone, Human, N-FLAG tag

ARRB1 cDNA ORF Clone, Human, N-FLAG tag

SPD-15764

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human arrestin, beta 1 with N terminal Flag tag.
Target Information
Species Human
Target Name β-Arrestin 1
Gene Abbr. ARRB1
Gene ID 408
Full Name arrestin beta 2
Alias ARB1, ARR1
Introduction Arrestin proteins function as negative regulators of G protein-coupled receptor (GPCR) signaling. Cognate ligand binding stimulates GPCR phosphorylation, which is followed by binding of arrestin to the phosphorylated GPCR and the eventual internalization of the receptor and desensitization of GPCR signaling. Four distinct mammalian arrestin proteins are known. Arrestin 1 (also known as S-arrestin) and arrestin 4 (X-arrestin) are localized to retinal rods and cones, respectively. Arrestin 2 (also known as β-arrestin 1) and arrestin 3 (β-arrestin 2) are ubiquitously expressed and bind to most GPCRs. β-arrestins function as adaptor and scaffold proteins and play important roles in other processes, such as recruiting c-Src family proteins to GPCRs in Erk activation pathways. β-arrestins are also involved in some receptor tyrosine kinase signaling pathways. Additional evidence suggests that β-arrestins translocate to the nucleus and help regulate transcription by binding transcriptional cofactors.Erk1/2 constitutively phosphorylates β-arrestin 1 at carboxy-terminal Ser412, which promotes cytosolic localization of the scaffold protein. Agonist stimulation of β2-adrenergic receptors results in recruitment of β-arrestin 1 to the plasma membrane and rapid dephosphorylation of arrestin. Dephosphorylation is an essential step of β-arrestin 1-mediated receptor endocytosis, but it is not required for receptor desensitization.
Product Details
Description Full length Clone DNA of Human arrestin, beta 1 with N terminal Flag tag.
NCBI Ref Seq BC003636
RefSeq ORF Size 1296 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + NotI (6kb + 1.3kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.